Ikaros (IK) is a zinc finger (ZF)-containing sequence-specific DNA-binding protein encoded by the IKZF1 gene. It plays a pivotal role in immune homeostasis through transcriptional regulation of the earliest stages of lymphocyte ontogeny and differentiation by both (a) gene transcriptional activation via efficient transcription initiation and elongation as well as (b) repression (Georgopoulos et al.,1994; Dovat et al., 2011).  In recent years, there have been a series of contradictory reports based on studies that employed single-nucleotide polymorphism (SNP) arrays regarding the incidence and prognostic significance of IKZF1 deletions in primary leukemic cells from pediatric patients with high-risk B-cell precursor ALL (BPL) (Mullighan et al., 2008; Mullighan et al., 2009; Chen et al., 2012; Harvey et al., 2010; Volejnikova et al., 2012; Dörge et al., 2011; Palmi et al., 2013). Some of the initial reports have proposed that genomic IKZF1 deletions (not alternative splicing) are the cause of expression of dominant-negative IK isoforms (Mullighan et al., 2008; Mullighan et al., 2009). Mullighan et al. (2008) reported deletions of IKZF1 in 84% of Ph⁺ BPL, including 76% of pediatric and 91% of adult Ph⁺ BPL cases. The same authors also reported a>25% frequency of IKZF1 deletions in Ph^- high-risk BPL patients (Mullighan et al., 2009).  In both studies, IKZF1 deletions included homozygous/biallelic as well as heterozygous/monoallelic deletion of the entire gene locus as well as intragenic deletions (Mullighan et al., 2008; Mullighan et al., 2009).  Subsequently, Volejnikova et al. (2012) reported discordant results in 206 children with Ph^- ALL.  Of 24 patients with overexpression of dominant-negative IK isoforms other than IK6, only one patient had a deletion within the IKZF1 locus and only half of the IK6+ cases were found to have monoallelic IKZF1 deletions (Volejnikova et al., 2012).  The overall incidence of IKZF1 deletions was only 7% and no patient had homozygous IKZF1 deletions and no patient had evidence of decreased IK protein expression even in the presence of monoallelic IKZF1 deletions (Volejnikova et al., 2012). Although Mullighan et al. (2009) reported IKZF1 deletions as a significant predictor of poor outcome for high-risk BPL patients on Children’s Oncology Group (COG) Study P9906, a subsequent study by Chen et al. (2012) could not confirm the independent prognostic significance of IKZF1 deletions for 499 high-risk BPL patients. In their most recent paper, Palmi et al. (2013) reported an elegant study, which raises further questions about the clinical significance of IKZF1 deletions in pediatric BPL. They documented no homozygous IKZF1 deletions and heterozygous IKZF1 deletions were detected in only ~13% of their Ph^- BPL patient population.  In approximately half of the cases with deletions (7.1%), the deletion involved the entire IKZF1 locus and in the other half a portion of the IKZF1 gene (Palmi et al., 2013). Most importantly, IKZF1 deletions were not an independent prognostic factor of the hazard of relapse (Palmi et al., 2013).

 

The purpose of the present study was to gain further insights into the incidence of IKZF1 deletions by using gene expression analysis using multiple probesets and exon-specific genomic PCR.  Our analysis revealed no evidence for homozygous or heterozygous IKZF1 deletions in Ph⁺ or Ph^- BPL and contradicts previous reports of IKZF1 deletions in BPL that were based on SNP array data.  

 

Cryopreserved leukemia cells from 21 children with newly diagnosed high risk B-precursor ALL, 11 children with newly diagnosed standard risk B-precursor ALL, 9 children with B-precursor ALL in first bone marrow relapse occurring within 12 months of the completion of primary therapy, and 8 infants (age <1 year) with newly diagnosed B-precursor ALL were examined for IK expression using multiple assay platforms. We also used ALL cells isolated from spleen specimens of xenografted NOD/SCID mice in the described experiments. The xenografts were established using primary cells from 7 pediatric B-precursor ALL patients. The IRB (CCI) at Children’s Hospital Los Angeles (CHLA) (Human Subject Assurance Number: FWA0001914) determined that the use of leukemic cells in our research did not meet the definition of human subject research per 45 CFR 46.102 (d and f) since it does not include identifiable private information. The research was approved by the CHLA CCI. The IRB approved project numbers were CCI-09-00304 (CCI Review Date 12/21/2009, Approval Date: 12/29/09) for cryopreserved cells and CCI-10-00141 (CCI Review Date 7/27/2010, Approval Date 7/27/2010) for freshly obtained primary leukemia cells. 
 

DNA sequencing was carried out using a “primer-walking” strategy and the BigDye Terminator v.3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), as previously reported (Uckun et al., 2012). Total genomic DNA was extracted from patients’ leukemia cells using the Qiagen DNeasy Blood & Tissue kit (Catalog No. 6950) according to the manufacturer’s specifications. PCR products encompassing the IKZF1 exons 4, 5, 6, 7 and their exon-intron junctions were amplified using previously reported genomic PCR primer sets (Uckun et al., 2012; Uckun et al., 2010).  PCR products were separated on 1% agarose gels and sized using the 1 kb Plus DNA ladder from Invitrogen (Cat. No. 10787-018). The PCR products were cleaned using the Qiagen QIAquick PCR Purification Kit (Cat No. 28104) and submitted to the DNA Sequencing Facility of Genewize Inc (CA) using the corresponding forward primer and the Applied Biosystems’ dye-based (BigDye V3.1^TM) DNA sequencing method.  DNA sequencing was performed on an ABI 3730 DNA Analyzer using a long read protocol. Sequence obtained from each genomic PCR product was analyzed and aligned using SeqMan II contiguous alignment software in the LaserGene suite from DNASTAR Inc. and the MegAlign multisequence alignment software in comparison with the wild-type IKZF1 sequence (NCBI Reference Sequence: NCBI Reference Sequence: NT_007819.17 Homo sapiens chromosome 7, Genome Reference Consortium Human Build 37 (GRCh37.p9) primary reference assembly, www.ncbi.nih.gov) (Uckun et al., 2010).  
 

Reverse transcription (RT) and polymerase chain reaction (PCR) were used according to the Qiagen OneStep RT-PCR (Qiagen, Cat# 210210) guidelines to amplify specific regions of the IKZF1 transcript.  Total cellular RNA was extracted from primary ALL cells or ALL cell lines using the Qiagen RNeasy Mini Kit (Cat No 74104) (Qiagen, Santa Clarita, CA). Total RNA (~100 ng/sample) was reversely transcribed and directly amplified in the same tube using 2 specific primer sets (viz. P1 and P2). The P1 primer set (Forward: CCAATGTGCTCATGGTTCAC, Reverse: CTCTTACGGTTTGGCGACGTT) was used to amplify a 442 bp region of the IKZF1 mRNA spanning Exons E5-E7. The P2 primer set (Forward: CCAATGTGCTCATGGTTCAC, Reverse: TAGCTTCGGCCACAATATCC) was used to amplify a 244 bp region (c.2180–c.2361) of the IKZF1 mRNA extending from E5 to E6. Both PCR products included ~1/8th of E4 and E4/E5 junction as well. The cycling conditions were: 30 min reverse-transcription reaction at 50? immediately followed by 15 min initial PCR activation step, and 35 cycles of 1 min denaturation at 94?, 1 min annealing at 58?, and 1 min extension at 72?. PCR products were separated on a 1.2% agarose gel and visualized after ethidium bromide staining using a UVP Epi Chemi ? Darkroom Transilluminator.

 

BLAT analysis on IKZF1 target sequences deposited in Affymetrix NetAffx™ Analysis Center (http://www.affymetrix.com/analysis/index.affx) mapped these probesets onto specific IKZF1 exons visualized using the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgBlat?command=start).  This analysis is designed to locate sequences of 95% and greater similarity of length 25 bases or more in the entire genome (Haferlach et al., 2010). The exon designation by comparing the BLAT analysis to 3 reference sequences (UCSC genes, Ensembl gene predictions, Human mRNA Genbank) were as follows: 1565817_at: Exon 1, chr7:50,348,436-50,348,502; 1565816_at: Exon 1-4 reverse strand, chr7:50,348,485-50,444,456; 1565818_s_at: Exon 4, chr7:50,444,230-50,444,480; 220704_at: Exon 3, chr7:50,368,140-50,368,398; 1557632_at: Exon 3, chr7:50,370,493-50,370,631; 216901_s_at: Exon 8, chr7:50,467,793-50,468,294; 205039_s_at: Exon 8, chr7:50,469,625-50,470,188; 205038_at: Exon 8, chr7:50,471,237-50,471,785; 227346_at: Exon 8, chr7:50,471,780-50,472,114; 227344_at: Exon 8, chr7:50,472,198-50,472,761.

 

We compiled the archived “The Microarray Innovations in Leukemia” (MILE) study gene expression profiling (GEP) data on primary leukemic cells (GSE13159) from 122 pediatric BCR-ABL+ BPL patients with t(9;22) translocation (Ph⁺), 237 pediatric BCR-ABL- BPL patients without t(9;22) translocation (Ph^-) and 74 normal bone marrow specimens (Haferlach et al., 2010).  Signal values for 10 IKZF1 probesets (Human Genome U133 Plus 2.0 Array: 1565816_at, 1565817_at, 1565818_s_at, 205038_at, 205039_s_at, 216901_s_at, 220704_at, 227344_at, 227346_at, 1557632_at) obtained from hybridization onto the Affymetrix Human Genome U133 Plus 2.0 Arrays were calculated using non-central trimmed mean of differences between perfect match and mismatch intensities with quantile normalization (DQN3, signal normalized with quantiles of the beta distribution with parameters p=1.2 and q=3 (Liu et al., 2006).  Mean expression levels of the 50 least abundant probesets were used as a comparison for absence of signal in the IKZF1 probesets.

 

As a validation set, we compiled the archived gene expression data on in primary leukemic cells from 155 pediatric Ph^- BPL patients and 20 Ph⁺ BPL patients on the Mullighan study (GSE12995) (Mullighan et al., 2009). Transcript signal values were obtained from hybridization onto the Affymetrix Human Genome U133A genechip arrays.  Trimmed mean target intensity of each array was globally scaled to 500 (MAS5 values) as the normalization method and log10 transformed to homogenize within group variances.  Mean expression levels of the 25 least abundant probesets were used as a comparison for absence of signal in the IKZF1 probesets.

 

We performed a two-way hierarchical clustering technique to organize expression patterns (MAS5 values or DQN3 values) such that sample and IKZF1 probesets having the similar expression profiles were grouped together using the average distance metric. The IKZF1 probesets were arranged on the x-axis and samples were arranged along the y-axis such that similar expression patterns were placed adjacent to each other ordered by the cluster algorithm. The heat map represented the color coded expression values of probesets ranging from low levels (blue) to high levels (red). Dendrograms were formed using the clustering algorithm that finds similar expression pattern of a pair of expression values and joins them together, then clusters of expression values are joined together to form larger and larger clusters until all of the responses were joined into one giant cluster. The joining of the clusters was depicted by the branch structure that connects individual expression patterns with larger groups and color coded for major cluster groupings.
 

 Outlier boxplots of the expression levels for all the subgroups were utilized to compare differences in distribution of expression for each probeset across all sub-groups of samples (depicting median, 75^th and 25^th quartiles, outlier whiskers defined as 1.5 times outside the interquartile range and a red brackets defining the modal concentration of 50% of the expression values). This non-parametric method identifies specimen samples with low expression across all IKZF1 probesets covering exons 1-8 and the absence of a probeset was determined by comparing the expression distribution of individual IKZF1 probesets with the upper outlier whisker of the least abundantly expressed probesets. A non-parametric medians test was performed to determine significant differences in the median rank scores between Ph⁺ and Ph^- BPL groups in the Mullighan study4 and between Ph⁺ BPL, Ph^- BPL and normal bone marrow groups in the MILE study (Haferlach et al., 2010).13 The median rank scores are either 1 or 0, depending on whether a rank is above or below the median rank and the Chi-Square statistic calculated the P-values (<0.05 deemed significant). We expect significant reductions in the rank scores across all IKZF1 probesets in samples with IKZF1 locus deletions.  Mixed Model Analysis of Variance analysis for standardized expression scores for combined MILE (GSE13159) and Mullighan (GSE12995) datasets (N= 534 samples (392 Ph^-, 142 Ph⁺) with three fixed factors (“Diagnosis” Ph^-, Ph⁺), “Probeset” (4 IKZF1 probesets common in both MILE and Mullighan studies), an interaction term for diagnosis x probeset  and a random factor, “case” for sample identification) was utilized for the analysis of differential IKZF1 probeset expression levels. Planned Linear contrasts were performed using the fitted parameters from the interaction term to compare Ph+ versus Ph- BPL for each of the 4 probesets (205038_at, 205039_s_at, 216901_s_at and 220704_at).  All calculations were performed using JMP statistical package (JMP v10, SAS, Cary, NC).

 

In an effort to identify homozygous IKZF1 deletions, we performed exon-specific genomic PCR with DNA sequencing on purified genomic DNA samples from 21 patients with high risk BPL, including 3 patients with BCR-ABL+ ALL.  As shown in Figure 1A-D, no homozygous deletions involving E4-E7 were found in any of the 21 cases.  Further, no mutations were detected in E4-E7 or adjacent intronic segments. This absence of genomic deletions in the E4-E7 segment encoding the DNA binding domain of IK prompted us to further validate our findings using RT-PCR analyses designed to detect IK6 transcripts with high accuracy.  

Figure 1 Genomic PCR analysis of the human Ikaros/IKFZ1 gene exons E4-E7 in high  risk B-precursor ALL

Specifically, primary leukemia cells from 6 high-risk B-precursor ALL patients, including 3 patients with BCR-ABL+ ALL, were subjected to RT-PCR analyses designed to amplify a 442 bp region of the IKZF1 cDNA extending from distal portion of E4 to E7 as well as a 244 bp region of the IKZF1 cDNA extending from distal portion of E4 to E6.  A single PCR product of the appropriate size was detected in these PCR assays without any evidence of a homozygous or heterozygous deletion of E5, E6, or E7 either alone or in combination, which would have resulted in substantially smaller transcripts alone or in combination with the regular size transcripts (Figure 1E). Likewise, no exonic deletions or mutations involving E4-E7 were detected in genomic DNA samples from 11 patients with standard risk pediatric BPL (Figure 2A) or 8 patients with infant BPL (Figure 2B).  Taken together, these findings collectively demonstrate that homozygous IKZF1 deletions are not consistent abnormalities in pediatric high-risk BPL and they are not signature characteristics of pediatric BCR-ABL+ BPL.  

Figure 2 Genomic PCR analysis of the human IKFZ1/Ikaros gene exons E4-E7

 

In order to gain further insights into the incidence and biological significance of IKZF1 deletions, we examined the expression levels of IKZF1 transcripts in primary leukemic cells from Ph- BPL patients in side by side comparison with pediatric Ph+ BPL cases and normal bone marrow specimens in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database GSE 13159 (Haferlachckwx et al., 2010).  BLAT analysis on IKZF1 target sequences mapped the 10 probesets from the Affymetrix Human Genome U133 Plus 2.0 Arrays used in the analysis onto specific IKZF1 exons visualized using the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgBlat?command=start).  The IKZF1 probesets were mapped onto common IKZF1 deletion regions to identify which probesets would be expected to exhibit reduced gene expression in samples with the IKZF1 deletions (Qazi and  Uckun, 2013). Specifically, the examination of the Affymetrix probeset coverage in relation to most common IKZF1 micro deletions and complete IKZF1 locus deletions reported to occur in Ph⁺ BPL cases revealed that each of these deletions can be detected by gene expression profiling using multiple IKZF1 probesets.  The most common microdeletion occurs between exons 4-7 (30%) and can be detected by 1565816_at and 1565818_s_at followed by deletion of exons 2-7 (15%) that can be detected by 1565816_at, 1565818_s_at, 220704_at, 1557632_at) and large chromosome deletions (15%) that can be detected by 9 of 10 IKZF1 probesets.16 Primary leukemia cells from 122 Ph⁺ BPL patients and 237 Ph^- BPL patients as well as normal hematopoietic cells from  74 normal  non-leukemic bone marrow specimens from the MILE study (GSE 13159) were organized according DQN3 expression levels of 10 IKZF1 transcripts utilizing two-way hierarchical clustering technique (Average distance metric) to identify specimens with low IKZF1 expression for the 10 probesets interrogating Exons 1 through 4 and Exon  8. Our analysis demonstrated no changes in expression that would be expected from homozygous or heterozygous deletions of IKZF1 in primary leukemic cells.  In particular, the probesets 1565816_at and 1565818_s_at specific for Exon 4 did not detect any reduced expression levels in Ph⁺ or Ph^- BPL vs. normal bone marrow specimens, to suggest a heterozygous intragenic deletion between Exons 4-7 or Exons 2-7.  Box plots depicted in Figure 3 illustrate the distribution of expression levels for each probeset color coded with respect to the sample clustering order. Four probesets for exon 8 (205038_at, 205039_s_at, 227344_at, 227346_at) were highly correlated across 433 samples.   In comparison to the negative control expression values (mean of 50 lowest abundant probesets), all 433 samples for 7 probesets (1565818_s_at, 205038_at, 205039_s_at, 220704_at, 227344_at, 227346_at, 1557632_at) were greater than the upper outlier range for negative controls.  Only one Ph⁺ BPL case exhibited lower expression across all 10 probesets (Figure 3A).  For 8 out of the 10 probesets, the proportions of above median expression values were greater for Ph⁺ vs. Ph^- BPL cells and expression values for only one probeset, 1565818_s_at, exhibited borderline significance (P=0.063) for reduced proportion above median expression in Ph⁺ BPL cells compared to either Ph^- PBL cells or normal hematopietic cells (Figure 3B).  Likewise, gene expression profiles of primary leukemic cells from 20 Ph⁺ positive and 155 Ph^- BPL patients from the original Mullighan study (GSE12995) (Mullighan et al., 2009) were organized according to log10 transformed MAS5 expression levels of 4 IKZF1 probesets utilizing a two-way hierarchical clustering technique to identify specimens with low IKZF1 expression for the 4 probesets interrogating Exons 3 and 8. As with the MILE study dataset, we found no changes in IKZF1 expression that would be expected from homozygous or heterozygous deletions of IKZF1 in primary leukemic cells. Box plots depicted in Figure 4 illustrate the distribution of expression levels for each probeset and color coded with respect to the sample clustering order. Two probesets for IKZF1 expression were highly correlated across 175 samples (205038_at and 205039_s_at). In comparison to the mean expression of 25 lowest abundant probesets, all samples for probesets 205038_at and 205039_s_at were greater than the upper outlier whisker of these negative controls. Only one Ph⁺ BPL case, that was a member of the cluster of expression values below the outlier range for probeset 216901_s_at, exhibited low expression across all 4 probesets (Figure 4A). No statistically significant differences were found between Ph⁺ vs. Ph^- BPL cases relative to the proportions of cases with above median expression values for the 4 probesets (Figure 4B). 

Figure 3 Analysis of pimary Ph+ vs. Ph- BPL cells for IKZF1 deletions by gene expression analysis using 10 probesets for exons 1-4 and 8

Figure 4 Analysis of primary Ph+ vs. Ph- BPL cells for IKZF1 deletions by gene expression analysis using exon 3 and exon 8 probesets

 

We next employed a mixed ANOVA model for the combined datasets comparing Ph⁺ and Ph^- BPL cases using standardized expression values. The model explained 56% of the total variation in the probeset expression data across all 4 IKZF1 transcripts accounting for both fixed and random factors.  Relative variance components of the total   variation explained for the fixed and random factors for individual cases were 54.6% and 45.4% respectively. Significant effects of Probeset (F_3,1596 = 2.668, P=0.046), a strong trend in the Diagnosis factor exhibiting an increase in expression of 4 probesets in Ph+ BPL cases (F_1,532 = 3.188, P = 0.075) and a non-significant Interaction term (F_3,1596 = 0.869, P=0.456) were observed for these fixed factors. Planned Linear Contrasts of Ph⁺ versus Ph^- BPL cases for each of the probesets exhibited a borderline increase in exon 3 probeset (220704_at) expression for Ph⁺ BPL cases (Effect size = 0.21 standard deviation units, T-ratio = 2.011, P = 0.0445) as well as a borderline increase for the 3 exon 8 probesets (Figure 5; Effect sizes for 205038_at, 205039_s_at and 216901_s_at showed increases of 0.046 (P = 0.66), 0.135 (P = 0.20) and 0.183 (P = 0.081) standard deviation units in Ph⁺ BPL cases respectively). These findings from the parametric ANOVA model are the opposite of what would be expected from a increased incidence of homozygous or heterozygous deletions of IKZF1 in primary leukemia cells from Ph⁺ BPL patients.  

 

Figure 5 Analysis of primary Ph+ vs. Ph- BPL cells for IKZF1 deletions by gene expression analysis using exon 3 and exon 8 probesets

4 Discussions

In the present study we examined the expression of IKZF1 in pediatric BPL. The analysis demonstrated no changes in expression that would be expected from homozygous or heterozygous deletions of IKZF1 in primary leukemic cells from Ph⁺ or Ph^- BPL patients.  In particular, the probesets 1565816_at (specific for Exons 1-4) and 1565818_s_at (specific for Exon 4 only) did not detect any significantly reduced expression levels in Ph⁺ or Ph^- BPL vs. normal bone marrow specimens controlling for repeated measures taken from individual cases, that would have suggested heterozygous intragenic deletions between exons 4-7 or exons 2-7 (Qazi and Uckun, 2013). Our results demonstrate that IKZF1 deletions are not common characteristics of high-risk BPL or its BCR-ABL+ subset in children. In particular, our IKZF1 gene expression analysis using multiple probesets contradicts previous reports suggesting Ph+ BPL in children is characterized by homozygous as well as heterozygous IKZF1 Deletions. Furthermore, our genotyping of primary leukemia cells from pediatric patients with high-risk ALL using exon-specific genomic PCR and sequencing revealed no homozygous deletions involving E4-E7 and no mutations in E4-E7 or their adjacent intronic segments. Based on the reported detection of IKZF1 deletions by SNP arrays, our findings indicate that IKZF1 deletions either occur in a minority of leukemic cells in a oligoclonal heterogeneous population of leukemic B-cell precursors or IKZF1 expression is characterized by “allelic imbalance” or “allelic exclusion” and deletions occur in “inactive” alleles (Qazi and Uckun, 2013).

 

While the earlier contradictory reports regarding the true incidence of IKZF1 deletions may be related to the different techniques used in the research laboratories and have little biologic significance since primary leukemia cells from high-risk B-precursor ALL patients are not IK-deficient, they need to be reconciled if IKZF1 deletions are to be used for clinical risk assignment and subsequent treatment decisions. Data quality of SNP arrays plays a key role in the accuracy and precision of downstream data analyses (Heinrichs et al., 2010; Flannick et al., 2012). An analysis of possibly contaminated data from SNP arrays or genotyping experiments can yield false-positive discoveries (Heinrichs et al., 2010; Flannick et al., 2012).  Therefore, for each SNP, simultaneous comparisons between matched leukemic DNA from diagnostic bone marrow specimens and normal DNA from skin or buccal biopsies is considered critically important (Heinrichs et al., 2010). Hence, it is of paramount importance that IK deletions be used as a diagnostic tool for clinical assignment of patients to a high-risk group only when the tests utilized are subject to additional validation of the results with inclusion of normal DNA controls from skin biopsies or buccal swabs (Heinrichs et al., 2010). 

 

The project described was supported in part by DHHS grants P30CA014089, U01-CA-151837, R01CA-154471 and R21-CA-164098 (FMU) from the National Cancer Institute. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Cancer Institute or the National Institutes of Health. This work was also supported in part by 2011 V-Foundation Translational Research Award (FMU), Nautica Triathalon and its producer Michael Epstein (FMU), Ronald McDonald House Charities of Southern California (FMU), Couples Against Leukemia Foundation (FMU) and a William Lawrence & Blanche Hughes Foundation grant (FMU) and 2011 & 2012 Saban Research Institute Merit Awards (FMU). We further thank Mrs. Parvin Izadi of the CHLA Bone Marrow Laboratory for her assistance. 
 

F.M.U conceived and supervised this study and wrote the final manuscript. H.M and S.Q have equally contributed to this study.  All authors contributed to the design of the experiments and performed research. All authors reviewed and revised the paper. 

References
Chen I.M., Harvey R.C., Mullighan C.G., Gaster-Foster J., Wharton W., Kang H., Borowitz M.J., Camitta B.M., Carroll A.J., Devidas M., Pullen D.J., Payne-Turner D., Tasian S.K., Reshmi S., Cottrell C.E., Reaman G.H., Bowman W.P., Carroll W.L., Loh M.L., Winick N.J., Hunger S.P., and Willman C.L., 2012, Outcome modeling with CRLF2, IKZF1, JAK, and minimal residual disease in pediatric acute lymphoblastic leukemia: A Children's Oncology Group Study, Blood, 119:3512-3522
http://dx.doi.org/10.1182/blood-2011-11-394221
PMid:22368272 PMCid:PMC3325039
 
Dovat S., Song C., Payne K.J., and Li Z., 2011, Ikaros, CK2 kinase and the road to leukemia, Mol. Cell Biochem., 356 (1-2): 201-217
http://dx.doi.org/10.1007/s11010-011-0964-5
PMid:21750978 PMCid:PMC3665334
 
Dörge P., Meissner B., Zimmermann M., Möricke A., Schrauder A., Bouquin J.P., Schewe D., Harbott J., Teigler-Schlegel A., Ratei R., Ludwig W.D., Koehler R., Bartram C.R., Schrappe M., Stanulla M., and Cario G., 2013, IKZF1 deletion is an independent predictor of outcome in pediatric acute lymphoblastic leukemia treated according to the ALL-BFM 2000 protocol, Haematologica, 98(3): 428-32, doi: 10.3324/haematol.2011.056135
http://dx.doi.org/10.3324/haematol.2011.056135
 
Flannick J, Korn JM, Fontanillas P., Grant G.B., Banks E., Depristo M.A., and Altshuler D., 2012, Efficiency and power as a function of sequence coverage, SNP array density, and imputation, PLOS Comput Biol., 8(7) e1002604. doi: 10.1371/journal.pcbi.1002604
http://dx.doi.org/10.1371/journal.pcbi.1002604
 
Georgopoulos K., Bigby M., Wang J.H., Molnar A., Wu P., Winandy S., and Sharpe A., 1994, The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:143-15613
http://dx.doi.org/10.1016/0092-8674(94)90407-3
 
Heinrichs S., Li C., and Look A.T., 2010, SNP array analysis in hematologic malignancies: avoiding false discoveries, Blood 115:4157-4161
http://dx.doi.org/10.1182/blood-2009-11-203182
PMid:20304806 PMCid:PMC2879098
 
Harvey R., Mullighan C.G., Wang X., Dobbin K.K., Davidson G.S., Bedrick E.J., Chen I.M., Atlas S.R., Kang H., Ar K., Wilson C.S., Wharton W., Murphy M., Devidas M., Carroll A.J., Borowitz M.J., Bowman W.P., Downing J.R., Relling M., Yang J., Bhojwani D., Carroll W.L., Camitta B., Reaman G.H., Smith M., Hunger S.P., and Willman C.L., 2010, Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: Correlation with genome-wide DNA copy number alterations, clinical characteristics, and outcome, Blood, 116:4874-4884
http://dx.doi.org/10.1182/blood-2009-08-239681
PMid:20699438 PMCid:PMC3321747
 
Haferlach T., Kohlmann A., Wieczorek L., Basso G., Kronnie G.T., Bene M.C., DeVos J., Hernandez J.M., Hofmann W.K., Mils K.I., Gilkes A., Chiaretti S., Shurtleff S.A., Kipps T.J., Rassenti L.Z., Yeoh A.E., Papenhausen P.R., Liu W., Williams P.M., and Foa R., 2010, Clinical utility of micro-array based gene expression profiling in the diagnosis and subclassification of leukemia: report from the International Microarray innovations in leukemia Study Group, J. Clin. Oncol., 28: 2529-2537
http://dx.doi.org/10.1200/JCO.2009.23.4732
PMid:20406941
 
Kent W.J., 2002, BLAT--the BLAST-like alignment tool, Genome Res., 12(4):656-664
http://dx.doi.org/10.1101/gr.229202

http://dx.doi.org/10.1101/gr.229202
PMid:11932250 PMCid:PMC187518
 
Kastner P., Dupuis A., Gaub M.P., Herbrecht R., Lutz P., and Chan S., 2013, Function of Ikaros as a tumor suppressor in B cell acute lymphoblastic leukemia, Am J Blood Res., 3:1-13
PMid:23358883 PMCid:PMC3555193
 
Liu W.M., Li R., Sun J.Z., Wang J., Tsai J., Wen W., Kohlmann A., and Williams P.M., 2006, PQN and DQN: Algorithms for expression microarrays, J. Theoretical Biol., 243, 273-278
http://dx.doi.org/10.1016/j.jtbi.2006.06.017
PMid:16889801
 
Mullighan C.G., Miller C.B., Radtke I., Phillips L.A., Ma J., White D., Hughes T.P., Le Beau M.M., Pui C.H., Relling M.V., Shurtleff S.A., Downing J.R., 2008, BCR-ABL1 lymphoblastic leukemia is characterized by the deletion of Ikaros, Nature, 453: 110-114
http://dx.doi.org/10.1038/nature06866
PMid:18408710
 
Mullighan C.G., Su X., Zhang J., Radtke I., Philips L.A.A., Miller C.B., Ma J., Liu W., Cheng C., Schulman B.A., Harvey R.C., Chen I.M., Clifford R.J., Carroll W.L., reaman G., Bowman W.P., Devidas M., Gerhard D.S., Yang W., Relling M.V., Shurtleff S.A., Campana D., Borowitz S.P., Willman C.L., Downing J.R., 2009, Deletion of IKZF1 and Prognois in Aute Lymphoblastic Leukemia, N. Engl. J. Med., 360: 470-480
http://dx.doi.org/10.1056/NEJMoa0808253
PMid:19129520 PMCid:PMC2674612
 
Palmi C., Valsecchi M.G., Longinotti G., Silvestri D., Carrino V., Conter V., Basso G., Biondi A., Te Kronnie G., Cazzaniga G., 2013, What is the relevance of Ikaros gene deletions as prognostic marker in pediatric Philadelphia negative B-cell precursor acute lymphoblastic leukemia? Haematologica, [Epub ahead of print] doi: 10.3324/haematol.2012.075432
http://dx.doi.org/10.3324/haematol.2012.075432
 
Qazi S., and Uckun F.M., 2013, Incidence and biological significance of IKZF1/Ikaros gene deletions in pediatric philadelphia chromosome negative and philadelphia chromosome positive B-cell Precursor Acute Lymphoblastic Leukemia (BPL), Haematologica, in press
 
Uckun F.M., Ma H., Zhang J., Ozer Z., Dovat S., Mao C., Ishkhanian R., Goodman P., Qazi S., Serine phosphorylation by SYK is critical for nuclear localization and transcription factor function of Ikaros. Proc Natl Acad Sci U S A. 109(44):18072-7, 2012. doi: 10.1073/pnas.1209828109.
http://dx.doi.org/10.1073/pnas.1209828109
 
Uckun F.M., Goodman P., Ma H., Dibirdik I., and Qazi S., 2010, CD22 Exon 12 Deletion as a Novel Pathogenic Mechanism of Human B-Precursor Leukemia. Proc. Natl. Acad. Sci. USA,107:16852-16857
http://dx.doi.org/10.1073/pnas.1007896107
PMid:20841423 PMCid:PMC2947921
 
Volejnikova J., Mejstrikova E., Dörge P., Meissner B., Zimmermannova O., Svojgr K., Stanulla M., Cario G., Schrappe M., Stary J., Hrusak O., Trka J., and Fronkova E., 2012, Ikaros(IKZF1) alterations and minimal residual disease at day 15 asessed by flow cytometry predict prognosis of childhood BCR/ABL-negative actute lymphoblastic leukemia, Pediatr Blood Cancer, doi: 10.1002/pbc.24299
http://dx.doi.org/10.1002/pbc.24299